https://dna.physics.ox.ac.uk/api.php?action=feedcontributions&user=Ouldridge&feedformat=atomOxDNA - User contributions [en]2024-03-28T23:53:12ZUser contributionsMediaWiki 1.39.6https://dna.physics.ox.ac.uk/index.php?title=Publications&diff=833Publications2014-04-23T08:05:40Z<p>Ouldridge: fix typesetting on previous edit</p>
<hr />
<div>#T. E. Ouldridge, A. A. Louis and J. P. K. Doye, ''Phys. Rev. Lett''. '''104''', 178101 (2010)<br />
#:[http://prl.aps.org/abstract/PRL/v104/i17/e178101 DNA Nanotweezers Studied with a Coarse-Grained Model of DNA] ([http://arxiv.org/abs/0911.0555 arXiv])<br />
#T. E. Ouldridge, A. A. Louis and J. P. K. Doye, ''J. Chem. Phys'', '''134''', 085101 (2011)<br />
#:[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])<br />
#T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
#:[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
#F. Romano, A. Hudson, J. P. K. Doye, T. E. Ouldridge, A. A. Louis, ''J. Chem. Phys.'' '''136''', 215102 (2012)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v136/i21/p215102_s1 The effect of topology on the structure and free energy landscape of DNA kissing complexes] ([http://arxiv.org/abs/1203.3577 arXiv])<br />
#C. De Michele, L. Rovigatti, T. Bellini, F. Sciortino, ''Soft Matter'' '''8''', 8388 (2012)<br />
#:[http://pubs.rsc.org/en/content/articlelanding/2012/sm/c2sm25845e Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link] ([http://arxiv.org/abs/1204.0985 arXiv])<br />
#C. Matek, T. E. Ouldridge, A. Levy, J. P. K. Doye, A. A. Louis, ''J. Phys. Chem. B'' (2012)<br />
#:[http://pubs.acs.org/doi/abs/10.1021/jp3080755 DNA cruciform arms nucleate through a correlated but non-synchronous cooperative mechanism] ([http://arxiv.org/abs/1206.2636 arXiv])<br />
#P. Šulc, F. Romano, T. E. Ouldridge, L. Rovigatti, J. P. K. Doye, A. A. Louis, ''J. Chem. Phys.'' '''137''', 135101 (2012)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v137/i13/p135101_s1 Sequence-dependent thermodynamics of a coarse-grained DNA model] ([http://arxiv.org/abs/1207.3391 arxiv]) <br />
#F. Romano, D. Chakraborty, J. P. K. Doye, T. E. Ouldridge, A. A. Louis, ''J. Chem. Phys.'' '''138''', 085101 (2013)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v138/i8/p085101_s1 Coarse-grained simulations of DNA overstretching] ([http://arxiv.org/abs/1209.5892 arXiv])<br />
#P. Šulc, T. E. Ouldridge, F. Romano, J. P. K. Doye, A. A. Louis, ''Natural Computing'' (2013) <br />
#:[http://link.springer.com/article/10.1007%2Fs11047-013-9391-8 Simulating a burnt-bridges DNA motor with a coarse-grained DNA model] ([http://arxiv.org/abs/1212.4536 arXiv])<br />
#T. E. Ouldridge, R. L. Hoare, A. A. Louis, J. P. K. Doye, J. Bath, A. J. Turberfield, ''ACS Nano'' (2013) <br />
#:[http://pubs.acs.org/doi/abs/10.1021/nn3058483 Optimizing DNA nanotechnology through coarse-grained modelling: a two-footed DNA walker]<br />
#T. E. Ouldridge, P. Šulc, F. Romano, J. P. K. Doye, A. A. Louis, ''Nucleic Acids Res.'', (2013) <br />
#:[http://nar.oxfordjournals.org/content/early/2013/08/08/nar.gkt687 DNA hybridization kinetics: zippering, internal displacement and sequence dependence] ([http://arxiv.org/abs/1303.3370 arXiv])<br />
#J.P.K. Doye, T. E. Ouldridge, A. A. Louis, F. Romano, P. Šulc, C. Matek, B.E.K. Snodin, L. Rovigatti, J. S. Schreck, R.M. Harrison, W.P.J. Smith, ''Phys. Chem. Chem. Phys'' (2013)<br />
#:[http://pubs.rsc.org/en/content/articlelanding/2013/cp/c3cp53545b#!divAbstract Coarse-graining DNA for simulations of DNA nanotechnology] ([http://arxiv.org/abs/1308.3843 arXiv])<br />
# N. Srinivas, T. E. Ouldridge, P. Šulc, J. M. Schaeffer, B. Yurke, A. A. Louis, J. P. K. Doye, E. Winfree, ''Nucleic Acids Res.'', (2013)<br />
#:[http://nar.oxfordjournals.org/content/early/2013/09/07/nar.gkt801.full?sid=762d341b-b72f-4a09-9235-20ad3ef8aeed On the biophysics and kinetics of toehold-mediated DNA strand displacement]<br />
#L. Rovigatti, F. Bomboi, F. Sciortino, ''J. Chem. Phys.'' '''140''', 154903 (2014)<br />
#:[http://dx.doi.org/10.1063/1.4870467 Accurate phase diagram of tetravalent DNA nanostars] ([http://arxiv.org/abs/1401.2837 arXiv])<br />
# L. Rovigatti, P. Šulc, I. Reguly, F. Romano, ''arXiv'', (2014)<br />
#:[http://arxiv.org/abs/1401.4350 A comparison between parallelization approaches in molecular dynamics simulations on GPUs]<br />
#P. Šulc, F. Romano, T. E. Ouldridge, J. P. K. Doye, A. A. Louis, ''arXiv'' (2014) <br />
#:[http://arxiv.org/abs/1403.4180 A nucleotide-level coarse-grained model of RNA] ([http://arxiv.org/abs/1403.4180 arXiv])<br />
#L. Rovigatti, F. Smallenburg, F. Romano, F. Sciortino, ''ACS Nano'', (2014)<br />
#:[http://pubs.acs.org/doi/abs/10.1021/nn501138w Gels of DNA Nanostars Never Crystallise]<br />
#C. Matek, T. E. Ouldridge, J. P. K. Doye, A. A. Louis,''arXiv'', (2014)<br />
#:[http://arxiv.org/abs/1404.2869 Plectoneme tip bubbles: Coupled denaturation and writhing in supercoiled DNA]<br />
#Q. Wang, B. M. Pettitt, ''Biophys. J.'' '''106''', 1182–1193 (2014)<br />
#:[http://www.sciencedirect.com/science/article/pii/S0006349514000927 Modeling DNA Thermodynamics under Torsional Stress]</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Publications&diff=832Publications2014-04-23T08:04:22Z<p>Ouldridge: Added Pettitt paper</p>
<hr />
<div>#T. E. Ouldridge, A. A. Louis and J. P. K. Doye, ''Phys. Rev. Lett''. '''104''', 178101 (2010)<br />
#:[http://prl.aps.org/abstract/PRL/v104/i17/e178101 DNA Nanotweezers Studied with a Coarse-Grained Model of DNA] ([http://arxiv.org/abs/0911.0555 arXiv])<br />
#T. E. Ouldridge, A. A. Louis and J. P. K. Doye, ''J. Chem. Phys'', '''134''', 085101 (2011)<br />
#:[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])<br />
#T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
#:[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
#F. Romano, A. Hudson, J. P. K. Doye, T. E. Ouldridge, A. A. Louis, ''J. Chem. Phys.'' '''136''', 215102 (2012)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v136/i21/p215102_s1 The effect of topology on the structure and free energy landscape of DNA kissing complexes] ([http://arxiv.org/abs/1203.3577 arXiv])<br />
#C. De Michele, L. Rovigatti, T. Bellini, F. Sciortino, ''Soft Matter'' '''8''', 8388 (2012)<br />
#:[http://pubs.rsc.org/en/content/articlelanding/2012/sm/c2sm25845e Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link] ([http://arxiv.org/abs/1204.0985 arXiv])<br />
#C. Matek, T. E. Ouldridge, A. Levy, J. P. K. Doye, A. A. Louis, ''J. Phys. Chem. B'' (2012)<br />
#:[http://pubs.acs.org/doi/abs/10.1021/jp3080755 DNA cruciform arms nucleate through a correlated but non-synchronous cooperative mechanism] ([http://arxiv.org/abs/1206.2636 arXiv])<br />
#P. Šulc, F. Romano, T. E. Ouldridge, L. Rovigatti, J. P. K. Doye, A. A. Louis, ''J. Chem. Phys.'' '''137''', 135101 (2012)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v137/i13/p135101_s1 Sequence-dependent thermodynamics of a coarse-grained DNA model] ([http://arxiv.org/abs/1207.3391 arxiv]) <br />
#F. Romano, D. Chakraborty, J. P. K. Doye, T. E. Ouldridge, A. A. Louis, ''J. Chem. Phys.'' '''138''', 085101 (2013)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v138/i8/p085101_s1 Coarse-grained simulations of DNA overstretching] ([http://arxiv.org/abs/1209.5892 arXiv])<br />
#P. Šulc, T. E. Ouldridge, F. Romano, J. P. K. Doye, A. A. Louis, ''Natural Computing'' (2013) <br />
#:[http://link.springer.com/article/10.1007%2Fs11047-013-9391-8 Simulating a burnt-bridges DNA motor with a coarse-grained DNA model] ([http://arxiv.org/abs/1212.4536 arXiv])<br />
#T. E. Ouldridge, R. L. Hoare, A. A. Louis, J. P. K. Doye, J. Bath, A. J. Turberfield, ''ACS Nano'' (2013) <br />
#:[http://pubs.acs.org/doi/abs/10.1021/nn3058483 Optimizing DNA nanotechnology through coarse-grained modelling: a two-footed DNA walker]<br />
#T. E. Ouldridge, P. Šulc, F. Romano, J. P. K. Doye, A. A. Louis, ''Nucleic Acids Res.'', (2013) <br />
#:[http://nar.oxfordjournals.org/content/early/2013/08/08/nar.gkt687 DNA hybridization kinetics: zippering, internal displacement and sequence dependence] ([http://arxiv.org/abs/1303.3370 arXiv])<br />
#J.P.K. Doye, T. E. Ouldridge, A. A. Louis, F. Romano, P. Šulc, C. Matek, B.E.K. Snodin, L. Rovigatti, J. S. Schreck, R.M. Harrison, W.P.J. Smith, ''Phys. Chem. Chem. Phys'' (2013)<br />
#:[http://pubs.rsc.org/en/content/articlelanding/2013/cp/c3cp53545b#!divAbstract Coarse-graining DNA for simulations of DNA nanotechnology] ([http://arxiv.org/abs/1308.3843 arXiv])<br />
# N. Srinivas, T. E. Ouldridge, P. Šulc, J. M. Schaeffer, B. Yurke, A. A. Louis, J. P. K. Doye, E. Winfree, ''Nucleic Acids Res.'', (2013)<br />
#:[http://nar.oxfordjournals.org/content/early/2013/09/07/nar.gkt801.full?sid=762d341b-b72f-4a09-9235-20ad3ef8aeed On the biophysics and kinetics of toehold-mediated DNA strand displacement]<br />
#L. Rovigatti, F. Bomboi, F. Sciortino, ''J. Chem. Phys.'' '''140''', 154903 (2014)<br />
#:[http://dx.doi.org/10.1063/1.4870467 Accurate phase diagram of tetravalent DNA nanostars] ([http://arxiv.org/abs/1401.2837 arXiv])<br />
# L. Rovigatti, P. Šulc, I. Reguly, F. Romano, ''arXiv'', (2014)<br />
#:[http://arxiv.org/abs/1401.4350 A comparison between parallelization approaches in molecular dynamics simulations on GPUs]<br />
#P. Šulc, F. Romano, T. E. Ouldridge, J. P. K. Doye, A. A. Louis, ''arXiv'' (2014) <br />
#:[http://arxiv.org/abs/1403.4180 A nucleotide-level coarse-grained model of RNA] ([http://arxiv.org/abs/1403.4180 arXiv])<br />
#L. Rovigatti, F. Smallenburg, F. Romano, F. Sciortino, ''ACS Nano'', (2014)<br />
#:[http://pubs.acs.org/doi/abs/10.1021/nn501138w Gels of DNA Nanostars Never Crystallise]<br />
#C. Matek, T. E. Ouldridge, J. P. K. Doye, A. A. Louis,''arXiv'', (2014)<br />
#:[http://arxiv.org/abs/1404.2869 Plectoneme tip bubbles: Coupled denaturation and writhing in supercoiled DNA]<br />
#Q. Wang, B. M. Pettitt,''Biophys. J.'' "'106'", 1182–1193 (2014)<br />
#:[http://www.sciencedirect.com/science/article/pii/S0006349514000927 Modeling DNA Thermodynamics under Torsional Stress]</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Publications&diff=563Publications2012-06-14T07:19:48Z<p>Ouldridge: </p>
<hr />
<div>#T.E. Ouldridge, A.A. Louis and J.P.K. Doye, ''Phys. Rev. Lett''. '''104''', 178101 (2010)<br />
#:[http://prl.aps.org/abstract/PRL/v104/i17/e178101 DNA Nanotweezers Studied with a Coarse-Grained Model of DNA] ([http://arxiv.org/abs/0911.0555 arXiv])<br />
#T.E. Ouldridge, A.A. Louis and J.P.K. Doye, ''J. Chem. Phys'', '''134''', 085101 (2011)<br />
#:[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])<br />
#T.E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
#:[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
#F. Romano, A. Hudson, J.P.K. Doye, T.E. Ouldridge, A.A. Louis, ''J. Chem. Phys.'' '''136''', 215102 (2012)<br />
#:[http://jcp.aip.org/resource/1/jcpsa6/v136/i21/p215102_s1 The effect of topology on the structure and free energy landscape of DNA kissing complexes] ([http://arxiv.org/abs/1203.3577 arXiv])<br />
#C. De Michele, L. Rovigatti, T. Bellini, F. Sciortino, ''arXiv'' (2012)<br />
#:[http://arxiv.org/abs/1204.0985 Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link]<br />
#C. Matek, T. E. Ouldridge, A. Levy, Jonathan P. K. Doye, A. A. Louis, "arxiv" (2012)<br />
#:[http://arxiv.org/abs/1206.2636 DNA cruciform arms nucleate through a correlated but non-synchronous cooperative mechanism]</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Main_Page&diff=190Main Page2012-04-16T17:13:02Z<p>Ouldridge: /* Acknowledgments */</p>
<hr />
<div>== oxDNA == <br />
<br />
oxDNA is a simulation code that implements the coarse-grained DNA model introduced by T. E. Ouldridge, J. P. K. Doye and A. A. Louis{{cite journal|journal=J. Chem. Phys|author=T. E. Ouldridge|doi=10.1063/1.3552946|year=2011|volume=134|page=085101}}. The code implements Monte Carlo and Brownian Dynamics and can be used as a basis to numerically study DNA systems. The developers are F. Romano, P. Šulc and T. E. Ouldridge in the [http://physchem.ox.ac.uk/~doye/jon/ Doye] and [http://www-thphys.physics.ox.ac.uk/people/ArdLouis/ Louis] groups at the University of Oxford and L. Rovigatti in the [http://pacci.phys.uniroma1.it/?q=node/40 Sciortino] group in Rome.<br />
<br />
The model is intended to provide a physical representation of the thermodynamic and mechanical properties of single- and double-stranded DNA, as well as the transition between the two. At the same time, the representation of DNA is sufficiently simple to allow access to assembly processes which occur on long timescales, beyond the reach of atomistic simulations. Basic examples include duplex formation from single strands, and the folding of a self-complementary single strand into a hairpin. These are the underlying processes of the fast-growing field of [http://en.wikipedia.org/wiki/DNA_nanotechnology DNA nanotechnology], as well as many biophysical uses of DNA, allowing the model to be used to understand these fascinating systems.<br />
<br />
* [[Download and Installation]]<br />
<br />
* [[Features]]<br />
<br />
* [[Model introduction]]<br />
<br />
* [[Documentation]]<br />
<br />
* [[:Category:Examples|Examples]]<br />
<br />
* [[Screenshots]]<br />
<br />
* [[Publications]]<br />
<br />
== Acknowledgments ==<br />
<br />
We thank our co-workers C. Matek, B. Snodin and W. Smith for having contributed bits of code and/or material for the example</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Pseudoknot_formation&diff=189Pseudoknot formation2012-04-16T17:12:01Z<p>Ouldridge: </p>
<hr />
<div>[[Category:Examples]]<br />
<br />
<br />
=WORK IN PROGRESS=<br />
<br />
One of the features of the model implemented in oxDNA is that it has a<br />
three-dimensional structure, so that it automatically incorporates<br />
topological effects (see [[Publications|Ref 3]]). In this example we will see how<br />
to initialise a single strand in with a sequence designed to form a<br />
pseudoknot in its final configuration.<br />
<br />
The simplest option is to just generate a single strand with the right<br />
sequence, let it run at low temperature and wait for it to form the<br />
pseudoknot. Unfortunately, this can be very slow, as the formation of the<br />
pseudoknot requires two rare events (the closure of two hairpins). One<br />
should keep in mind that lowering the temperature to drive the formation of<br />
the pseuoknot can backfire, since the life of metastable states becomes<br />
longer and longer. Nevertheless, this is a perfectly acceptable solution.<br />
<br />
A second option is to design a specific sequence, where we use "arbitrary"<br />
bases that only bind to one specific other base. This allows to eliminate<br />
metastable states in the pseudoknot formation, so that one can safely lower<br />
the temperature at will (keeping in mind that the model is physically<br />
meaningful only at temperatures where water is liquid).<br />
<br />
A third option is to drive the formation of the pseudoknot with artificial<br />
forces, as one in the [[Hairpin_formation|hairpin formation]] example. This is probably the<br />
most time-effective solution but requires a bit more work.<br />
<br />
We study the following sequence that forms, at low enough temperature,<br />
drives the formation of a pesudoknot with two 6-base pair stems and two<br />
8-base loops:<br />
<br />
<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt><br />
<br />
All the files needed to run this example are in the<br />
<tt>${oxDNA}/EXAMPLES/PSEUDOKNOT</tt> directory. The following assumes you<br />
work in that directory.<br />
<br />
==Option 1==<br />
You can run this example directly in the <tt>OPT1/</tt> directory.<br />
<br />
First, we use the configuration generator to generate an input<br />
configuration for a single strand. The box size does not matter as long as<br />
it is big enough to contain the structure, so 30 s.u. will do. The file<br />
<tt>pkseq.txt</tt> contains the above sequence. So, run<br />
<br />
<code>../../UTILS/generate-sa.py 30. pkseq.txt</code><br />
<br />
which generates <tt>generated.dat</tt> and <tt>generated.top</tt>.<br />
<br />
Now, we choose to run a Brownian dynamics simulation since it is much more<br />
efficient than Monte Carlo (in our implementation) in exploring phase<br />
space. We use the standard "aggressive" values for the thermostat (see<br />
[Thermostat]). We use the average model in this example. We set a fairly<br />
low temperature, let's say 20 Celsius, significantly below the melting<br />
temperature of the two hairpins in the average-base representation. A long<br />
simulation might be needed, so we start with 10^9 total steps.<br />
<br />
We can thus run<br />
<br />
<code>../../Release/oxDNA inputMD1</code><br />
<br />
and wait (possibly a long time) until the pseudoknot forms. It is not<br />
guaranteed that the structure will for within the quite long simulation. To<br />
detect its formation, we can run the <tt>structure analyser</tt> to detect<br />
the formation of the correct bonds. Also, in the 5th column in the energy<br />
file (extensive base-pairing contribution to the total energy) you expect a<br />
number close to -8 for the formed structure (-0.7 times 12 base pairs). A<br />
single hairpin will have around half of that.<br />
<br />
<br />
== Option 2 ==<br />
You can run this example directly in the <tt>OPT2/</tt> directory.<br />
<br />
In this case, we have to repeat the all the steps above except that we need<br />
to manually tweak the topology file to have specific binding of the bases.<br />
<br />
So, again generate the initial configuration with <tt>generate-sa.py</tt><br />
and copy the topology file to a new one. The example directory already<br />
contains a working specific topology file for the impatient.<br />
<br />
<code>cp generated.dat specific.dat</code>.<br />
<br />
As discussed in the description of the topology file, specific bases can be set up with<br />
two-digit numbers in the second column of the topology file, and<br />
complementarity is implemented if the sum is equal to 3 (negative numbers<br />
can be used). So if we want<br />
base number 0 and 26 to be bound, we can set their "type" (second column)<br />
to be 100 and -97, respectively. Pay close attention when modifying by hand<br />
the topology file, since it is very easy to make mistakes (base types don't add<br />
up to 3, using the wrong number, etc.). It makes sense to automatise this<br />
task.<br />
<br />
In this case, we want bases 0-5 to be bound to bases 26-21 and bases 14-19<br />
to be bound to bases 41-36. Modify the topology file so that complementary<br />
pairs have types corresponding to numbers with magnitude grater than 10 and<br />
that add up to 3. The poly-A sections in the loop can be left as<br />
<tt>A</tt>'s in the topology file.<br />
<br />
If you look into the file <tt>inputMD2</tt>, you will see that it is the<br />
same as <tt>inputMD1</tt> except that it uses <tt>specific.top</tt> as the<br />
topology file. If you decide to use the ready specific topology file, just<br />
copy it to <tt>specific.top</tt>. The temperature has also been lowered to<br />
0C, since we expect no unwanted metastable states.<br />
<br />
You can now run the code and see what happens. It should make base-pairs<br />
more rarely, but it should make only correct ones.<br />
<br />
<code>../../Release/oxDNA inputMD2</code><br />
<br />
<br />
==Option 3==<br />
Why wait if we just want to form a structure and are not interested in how<br />
it forms? The mutual_trap force is implemented exactly to form initial<br />
configurations, having no physical meaning. But getting an initial<br />
configuration is sometimes half of the job.<br />
<br />
In this case we can use either of the topology file described above. We<br />
choose to use Monte Carlo, though, so that we don't have to worry about<br />
tweaking the magnitude of the traps and the thermostat parameters not to<br />
make the system explode.<br />
<br />
First of all, we have to generate a file where we specify the external<br />
forces. We set up 4 traps, a mutual trap between particles 0 and 26 and a<br />
mutual trap between particles 14 and 39. These should be enough to drive<br />
the formation of the two stems in a relatively short time.<br />
<br />
So, for each of the pairs, we set up a trap like this in<br />
<tt>external.conf</tt>:<br />
<br />
<code><br />
{<br />
<br />
type = mutual_trap<br />
<br />
particle = 0<br />
<br />
ref_particle = 26<br />
<br />
stiff = 1.<br />
<br />
r0 = 1.5<br />
<br />
}<br />
<br />
<br />
{<br />
<br />
type = mutual_trap<br />
<br />
particle = 0<br />
<br />
ref_particle = 26<br />
<br />
stiff = 1.<br />
<br />
r0 = 1.5<br />
<br />
}<br />
<br />
</code><br />
<br />
Repeat the same block with the indexes 0 and 26 changed to 14 and 39. <br />
<br />
The file <tt>inputMC</tt> is a Monte Carlo input file with everything set<br />
up to use the <tt>external.conf</tt> file you just created.<br />
<br />
Running the program<br />
<br />
<code>../../Release/oxDNA inputMC</code><br />
<br />
should produce a pseudoknot within half an hour, maybe faster. In this case<br />
we don't need the temperature to drive the formation of the motif, so we<br />
can use room temperature.<br />
<br />
If you have any questions about this example, you can e-mail Flavio Romano.</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Category:Examples&diff=188Category:Examples2012-04-16T17:11:27Z<p>Ouldridge: </p>
<hr />
<div>This category contains some examples on how to use the code to study some simple systems.</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=187Model introduction2012-04-16T17:06:21Z<p>Ouldridge: </p>
<hr />
<div>The model treats DNA as a string of rigid nucleotides, which interact through potentials which depend on the position and orientation of the nucleotides. The interactions are:<br />
#Sugar-phosphate backbone connectivity,<br />
#Excluded volume,<br />
#Hydrogen bonding,<br />
#Nearest-neighbour stacking,<br />
#Cross-stacking between base-pair steps in a duplex,<br />
#Coaxial stacking.<br />
<br />
This interactions are illustrated below. Orientational modulations of the stacking potential encourage the bases to form coplanar stacks, the twist arising from the different length scales of the backbone separation and the optimum stacking separation. The possibility of unstacking allows single strands to be very flexible. Hydrogen bonding can occur between complementary bases when they are anti-aligned, leading to the formation of double helical structures.<br />
<br />
http://www-thphys.physics.ox.ac.uk/people/ThomasOuldridge/Site/The_model.png<br />
<br />
(a) Model interaction sites with their interaction ranges (the typical range of an interaction is twice the radius of the sphere shown).<br />
<br />
(b) Representation of these interaction site in a visualisation that makes the planarity of the base clear.<br />
<br />
(c) A duplex in this representation.<br />
<br />
<br />
http://www-thphys.physics.ox.ac.uk/people/ThomasOuldridge/Site/interactions.png<br />
<br />
Indication of the interactions which hold together a typical duplex. V(b.b.) indicates the phosphate-sugar backbone connectivity.<br />
<br />
In the original model, all complementary base pairs and stacking partners interact with the same strength (there is no attractive interaction between non-complementary bases). A preliminary sequence-dependent parameterisation of the hydrogen-bonding and stacking interactions is included as an option in the code release: a paper discussing this parameterisation and its effects is currently in preparation.<br />
<br />
The model does not incorporate the differentiation between the major and minor grooves of DNA double helices, and incorporates electrostatics only through the short-ranged excluded volume. For this reason, it is only appropriate for the study of systems at high salt concentration, when electrostatic interactions are strongly screened.<br />
<br />
The code uses dimensionless energy, mass, length and timescales for convenience. The relationship between simulation units (SU) and SI units is given below.<br />
<br />
{|<br />
|-<br />
! Simulation unit <br />
! Physical unit<br />
|-<br />
| 1 unit of length<br />
| 8.518E-10 m<br />
|-<br />
| 1 unit of length<br />
| 4.142E-20 J<br />
|-<br />
| 1 unit of Temperature <br />
| 3000 K<br />
|-<br />
| 1 unit of Force<br />
| 4.863E-11 N<br />
|-<br />
| 1 unit of Mass<br />
| 1.66E-25 kg<br />
|-<br />
| 1 unit of Time<br />
| 1.71E-12 s<br />
|-<br />
|}<br />
<br />
<br />
The model and its performance is discussed in detail in the following references (the thesis provides the most complete analysis):<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T. E. Ouldridge, A. A. Louis and J. P. K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=180Model introduction2012-04-16T16:52:33Z<p>Ouldridge: </p>
<hr />
<div>The model treats DNA as a string of rigid nucleotides, which interact through potentials which depend on the position and orientation of the nucleotides. The interactions are:<br />
#Sugar-phosphate backbone connectivity,<br />
#Excluded volume,<br />
#Hydrogen bonding,<br />
#Nearest-neighbour stacking,<br />
#Cross-stacking between base-pair steps in a duplex,<br />
#Coaxial stacking.<br />
<br />
This interactions are illustrated below. Orientational modulations of the stacking potential encourage the bases to form coplanar stacks, the twist arising from the different length scales of the backbone separation and the optimum stacking separation. The possibility of unstacking allows single strands to be very flexible. Hydrogen bonding can occur between complementary bases when they are anti-aligned, leading to the formation of double helical structures.<br />
<br />
http://www-thphys.physics.ox.ac.uk/people/PetrSulc/images/stateX.png<br />
Invading and victim strands that are coaxially stacked<br />
<br />
http://www-thphys.physics.ox.ac.uk/people/Thomas Ouldridge/Site/interactions.png<br />
Invading and victim strands that are coaxially stacked<br />
<br />
In the original model, all complementary base pairs and stacking partners interact with the same strength (there is no attractive interaction between non-complementary bases). A preliminary sequence-dependent parameterisation of the hydrogen-bonding and stacking interactions is included as an option in the code release: a paper discussing this parameterisation and its effects is currently in preparation.<br />
<br />
The model does not incorporate the differentiation between the major and minor grooves of DNA double helices, and incorporates electrostatics only through the short-ranged excluded volume. For this reason, it is only appropriate for the study of systems at high salt concentration, when electrostatic interactions are strongly screened.<br />
<br />
The code uses dimensionless energy, mass, length and timescales for convenience. The relationship between simulation units (SU) and SI units is given below.<br />
<br />
{|<br />
|-<br />
! Simulation unit <br />
! Physical unit<br />
|-<br />
| 1 unit of length<br />
| 8.518E-10 m<br />
|-<br />
| 1 unit of length<br />
| 4.142E-20 J<br />
|-<br />
| 1 unit of Temperature <br />
| 3000 K<br />
|-<br />
| 1 unit of Force<br />
| 4.863E-11 N<br />
|-<br />
| 1 unit of Mass<br />
| 1.66E-25 kg<br />
|-<br />
| 1 unit of Time<br />
| 1.71E-12 s<br />
|-<br />
|}<br />
<br />
<br />
The model and its performance is discussed in detail in the following references (the thesis provides the most complete analysis):<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T. E. Ouldridge, A. A. Louis and J. P. K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Publications&diff=176Publications2012-04-16T16:36:43Z<p>Ouldridge: </p>
<hr />
<div>#T.E. Ouldridge, A.A. Louis and J.P.K. Doye, ''J. Chem. Phys'', '''134''', 085101 (2011)<br />
#:[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])<br />
#T.E. Ouldridge, A.A. Louis and J.P.K. Doye, ''Phys. Rev. Lett''. '''104''', 178101 (2010)<br />
#:[http://prl.aps.org/abstract/PRL/v104/i17/e178101 DNA Nanotweezers Studied with a Coarse-Grained Model of DNA] ([http://arxiv.org/abs/0911.0555 arXiv])<br />
#F. Romano, A. Hudson, J.P.K. Doye, T.E. Ouldridge, A.A. Louis, ''arXiv'' (2012)<br />
#:[http://arxiv.org/abs/1203.3577 The effect of topology on the structure and free energy landscape of DNA kissing complexes]<br />
#C. De Michele, L. Rovigatti, T. Bellini, F. Sciortino, ''arXiv'' (2012)<br />
#:[http://arxiv.org/abs/1204.0985 Self-assembly of short DNA duplexes: from a coarse-grained model to experiments through a theoretical link]<br />
#T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
#:[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=174Model introduction2012-04-16T16:34:21Z<p>Ouldridge: </p>
<hr />
<div>The model treats DNA as a string of rigid nucleotides, which interact through potentials which depend on the position and orientation of the nucleotides. The interactions are:<br />
#Sugar-phosphate backbone connectivity,<br />
#Excluded volume,<br />
#Hydrogen bonding,<br />
#Nearest-neighbour stacking,<br />
#Cross-stacking between base-pair steps in a duplex,<br />
#Coaxial stacking.<br />
<br />
This interactions are illustrated in PICTURE. Orientational modulations of the stacking potential encourage the bases to form coplanar stacks, the twist arising from the different length scales of the backbone separation and the optimum stacking separation. The possibility of unstacking allows single strands to be very flexible. Hydrogen bonding can occur between complementary bases when they are anti-aligned, leading to the formation of double helical structures.<br />
<br />
In the original model, all complementary base pairs and stacking partners interact with the same strength (there is no attractive interaction between non-complementary bases). A preliminary sequence-dependent parameterisation of the hydrogen-bonding and stacking interactions is included as an option in the code release: a paper discussing this parameterisation and its effects is currently in preparation.<br />
<br />
The model does not incorporate the differentiation between the major and minor grooves of DNA double helices, and incorporates electrostatics only through the short-ranged excluded volume. For this reason, it is only appropriate for the study of systems at high salt concentration, when electrostatic interactions are strongly screened.<br />
<br />
The code uses dimensionless energy, mass, length and timescales for convenience. The relationship between simulation units (SU) and SI units is given below.<br />
<br />
{|<br />
|-<br />
! Simulation unit <br />
! Physical unit<br />
|-<br />
| 1 unit of length<br />
| 8.518E-10 m<br />
|-<br />
| 1 unit of length<br />
| 4.142E-20 J<br />
|-<br />
| 1 unit of Temperature <br />
| 3000 K<br />
|-<br />
| 1 unit of Force<br />
| 4.863E-11 N<br />
|-<br />
| 1 unit of Mass<br />
| 1.66E-25 kg<br />
|-<br />
| 1 unit of Time<br />
| 1.71E-12 s<br />
|-<br />
|}<br />
<br />
<br />
The model and its performance is discussed in detail in the following references (the thesis provides the most complete analysis):<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T. E. Ouldridge, A. A. Louis and J. P. K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=163Model introduction2012-04-16T15:58:24Z<p>Ouldridge: </p>
<hr />
<div>The model treats DNA as a string of rigid nucleotides, which interact through potentials which depend on the position and orientation of the nucleotides. The interactions are:<br />
#Sugar-phosphate backbone connectivity,<br />
#Excluded volume,<br />
#Hydrogen bonding,<br />
#Nearest-neighbour stacking,<br />
#Cross-stacking between base-pair steps in a duplex,<br />
#Coaxial stacking.<br />
<br />
This interactions are illustrated in PICTURE. Orientational modulations of the stacking potential encourage the bases to form coplanar stacks, the twist arising from the different length scales of the backbone separation and the optimum stacking separation. The possibility of unstacking allows single strands to be very flexible. Hydrogen bonding can occur between complementary bases when they are anti-aligned, leading to the formation of double helical structures.<br />
<br />
In the original model, all complementary base pairs and stacking partners interact with the same strength (there is no attractive interaction between non-complementary bases). A preliminary sequence-dependent parameterisation of the hydrogen-bonding and stacking interactions is included as an option in the code release: a paper discussing this parameterisation and its effects is currently in preparation.<br />
<br />
The model does not incorporate the differentiation between the major and minor grooves of DNA double helices, and incorporates electrostatics only through the short-ranged excluded volume. For this reason, it is only appropriate for the study of systems at high salt concentration, when electrostatic interactions are strongly screened.<br />
<br />
+LENGTHSCALES IN THE MODEL<br />
<br />
The model and its performance is discussed in detail in the following references (the thesis provides the most complete analysis):<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T. E. Ouldridge, A. A. Louis and J. P. K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=162Model introduction2012-04-16T15:57:43Z<p>Ouldridge: </p>
<hr />
<div>The model treats DNA as a string of rigid nucleotides, which interact through potentials which depend on the position and orientation of the nucleotides. The interactions are:<br />
#Sugar-phosphate backbone connectivity,<br />
#Excluded volume,<br />
#Hydrogen bonding,<br />
#Nearest-neighbour stacking,<br />
#Cross-stacking between base-pair steps in a duplex,<br />
#Coaxial stacking.<br />
<br />
This interactions are illustrated in PICTURE. Orientational modulations of the stacking potential encourage the bases to form coplanar stacks, the twist arising from the different length scales of the backbone separation and the optimum stacking separation. The possibility of unstacking allows single strands to be very flexible. Hydrogen bonding can occur between complementary bases when they are anti-aligned, leading to the formation of double helical structures.<br />
<br />
In the original code, all complementary base pairs and stacking partners interact with the same strength (there is no attractive interaction between non-complementary bases). A preliminary sequence-dependent parameterisation of the hydrogen-bonding and stacking interactions is included as an option in the code release: a paper discussing this parameterisation and its effects is currently in preparation.<br />
<br />
The model does not incorporate the differentiation between the major and minor grooves of DNA double helices, and incorporates electrostatics only through the short-ranged excluded volume. For this reason, it is only appropriate for the study of systems at high salt concentration, when electrostatic interactions are strongly screened.<br />
<br />
+LENGTHSCALES IN THE MODEL<br />
<br />
The model and its performance is discussed in detail in the following references (the thesis provides the most complete analysis):<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T. E. Ouldridge, A. A. Louis and J. P. K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Model_introduction&diff=149Model introduction2012-04-16T15:32:10Z<p>Ouldridge: </p>
<hr />
<div>The model is discussed in detail in:<br />
<br />
T. E. Ouldridge, D.Phil. Thesis, University of Oxford, 2011.<br />
[http://ora.ox.ac.uk/objects/uuid:b2415bb2-7975-4f59-b5e2-8c022b4a3719 Coarse-grained modelling of DNA and DNA self-assembly]<br />
<br />
T.E. Ouldridge, A.A. Louis and J.P.K. Doye, J. Chem. Phys, 134, 085101 (2011)<br />
[http://link.aip.org/link/?JCP/134/085101 Structural, mechanical and thermodynamic properties of a coarse-grained DNA model] ([http://arxiv.org/abs/arXiv:1009.4480 arXiv])</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Main_Page&diff=147Main Page2012-04-16T15:26:31Z<p>Ouldridge: </p>
<hr />
<div>== oxDNA == <br />
<br />
oxDNA is a simulation code that implements the coarse-grained DNA model introduced by T. E. Ouldridge, J. P. K. Doye and A. A. Louis{{cite journal|journal=J. Chem. Phys|author=T. E. Ouldridge|doi=10.1063/1.3552946|year=2011|volume=134|page=085101}}. The code implements Monte Carlo and Brownian Dynamics and can be used as a basis to numerically study DNA systems. The developers are F. Romano, P. Šulc and T. E. Ouldridge in the [http://physchem.ox.ac.uk/~doye/jon/ Doye] and [http://www-thphys.physics.ox.ac.uk/people/ArdLouis/ Louis] groups at the University of Oxford and L. Rovigatti in the [http://pacci.phys.uniroma1.it/?q=node/40 Sciortino] group in Rome.<br />
<br />
The model is intended to provide a physical representation of the thermodynamic and mechanical properties of single- and double-stranded DNA, as well as the transition between the two. At the same time, the representation of DNA is sufficiently simple to allow access to assembly processes which occur on long timescales, beyond the reach of atomistic simulations. Basic examples include duplex formation from single strands, and the folding of a self-complementary single strand into a hairpin. These are the underlying processes of the fast-growing field of [http://en.wikipedia.org/wiki/DNA_nanotechnology DNA nanotechnology], as well as many biophysical uses of DNA, allowing the model to be used to understand these fascinating systems.<br />
<br />
* [[Download and Installation]]<br />
<br />
* [[Model introduction]]<br />
<br />
* [[Documentation]]<br />
<br />
* [[:Category:Examples|Examples]]<br />
<br />
* [[Screenshots]]<br />
<br />
* [[Publications]]<br />
<br />
== Acknowledgments ==<br />
<br />
We thank our co-workers C. Matek, B. Snodin and W. Smith for having contributed bits of code.<br />
<br />
== References ==<br />
<br />
{{RefList}}</div>Ouldridgehttps://dna.physics.ox.ac.uk/index.php?title=Main_Page&diff=141Main Page2012-04-16T15:19:27Z<p>Ouldridge: </p>
<hr />
<div>== oxDNA == <br />
<br />
oxDNA is a simulation code that implements the coarse-grained DNA model introduced by T. E. Ouldridge, J. P. K. Doye and A. A. Louis{{cite journal|journal=J. Chem. Phys|author=T. E. Ouldridge|doi=10.1063/1.3552946|year=2011|volume=134|page=085101}}. The code implements Monte Carlo and Brownian Dynamics and can be used as a basis to numerically study DNA systems. The developers are F. Romano, P. Šulc and T. E. Ouldridge in the [http://physchem.ox.ac.uk/~doye/jon/ Doye] and [http://www-thphys.physics.ox.ac.uk/people/ArdLouis/ Louis] groups at the University of Oxford and L. Rovigatti in the [http://pacci.phys.uniroma1.it/?q=node/40 Sciortino] group in Rome.<br />
<br />
The model is intended to provide a physical representation of the thermodynamic and mechanical properties of single- and double-stranded DNA, as well as the transition between the two. At the same time, the representation of DNA is sufficiently simple to allow access to assembly processes which occur on long timescales, beyond the reach of atomistic simulations. Basic examples include duplex formation from single strands, and the folding of a self-complementary single strand into a hairpin. These are the underlying processes of the fast-growing field of DNA nanotechnology, as well as many biophysical uses of DNA, allowing the model to be used to understand these fascinating systems.<br />
<br />
* [[Download and Installation]]<br />
<br />
* [[Model introduction]]<br />
<br />
* [[Documentation]]<br />
<br />
* [[:Category:Examples|Examples]]<br />
<br />
* [[Screenshots]]<br />
<br />
* [[Publications]]<br />
<br />
== Acknowledgments ==<br />
<br />
We thank our co-workers C. Matek, B. Snodin and W. Smith for having contributed bits of code.<br />
<br />
== References ==<br />
<br />
{{RefList}}</div>Ouldridge