Pseudoknot formation - Revision history

Randisi: Randisi moved page Pseudoknot to Pseudoknot formation: Title was too uninformative: now it's clear that the important bit is how to FORM a pseudoknot.

2016-09-14T20:34:39Z

Randisi moved page Pseudoknot to Pseudoknot formation: Title was too uninformative: now it's clear that the important bit is how to FORM a pseudoknot.

← Older revision	Revision as of 20:34, 14 September 2016
(No difference)

Snodinb: /* Option 3: forced formation */

2013-10-10T11:00:01Z

Option 3: forced formation

← Older revision		Revision as of 11:00, 10 October 2013
Line 112:		Line 112:
	configuration is sometimes half of the job.		configuration is sometimes half of the job.

	In this case we can use either of the topology ~~file~~ described above. We		In this case we can use either of the topology files described above. We
	choose to use Monte Carlo, though, so that we don't have to worry about		choose to use Monte Carlo, though, so that we don't have to worry about
	tweaking the magnitude of the traps and the thermostat parameters not to		tweaking the magnitude of the traps and the thermostat parameters not to

Snodinb: /* Option 3: forced formation */

2013-10-10T10:59:22Z

Option 3: forced formation

← Older revision		Revision as of 10:59, 10 October 2013
Line 109:		Line 109:
	Why wait if we just want to form a structure and are not interested in how		Why wait if we just want to form a structure and are not interested in how
	it forms? The mutual_trap force is implemented exactly to form initial		it forms? The mutual_trap force is implemented exactly to form initial
	configurations, ~~having no physical meaning~~. But getting an initial		configurations, although one should bear in mind that while using external forces such as the mutual_trap force, the simulation path itself will be unphysical. But getting an initial
	configuration is sometimes half of the job.		configuration is sometimes half of the job.

Snodinb: /* Option 3: forced formation */

2013-10-10T10:56:24Z

Option 3: forced formation

← Older revision		Revision as of 10:56, 10 October 2013
Line 149:		Line 149:
	Running the program		Running the program

	<pre>../../Release/oxDNA inputMC</pre>		<pre>../../../Release/oxDNA inputMC</pre>

	should produce a pseudoknot within an hour, maybe faster. In this case		should produce a pseudoknot within an hour, maybe faster. In this case
	we don't need the temperature to drive the formation of the motif, so we		we don't need the temperature to drive the formation of the motif, so we
	can use room temperature.		can use room temperature.

Snodinb: /* Option 2: specific sequence */

2013-10-10T10:56:13Z

Option 2: specific sequence

← Older revision		Revision as of 10:56, 10 October 2013
Line 104:		Line 104:
	more rarely, but it should make only correct ones.		more rarely, but it should make only correct ones.

	<pre>../../Release/oxDNA inputMD2</pre>		<pre>../../../Release/oxDNA inputMD2</pre>

	==Option 3: forced formation==		==Option 3: forced formation==

Snodinb: /* Option 1: spontaneous formation */

2013-10-10T10:56:02Z

Option 1: spontaneous formation

← Older revision		Revision as of 10:56, 10 October 2013
Line 43:		Line 43:
	<tt>pkseq.txt</tt> contains the above sequence. So, run		<tt>pkseq.txt</tt> contains the above sequence. So, run

	<pre>../../UTILS/generate-sa.py 30. pkseq.txt</pre>		<pre>../../../UTILS/generate-sa.py 30. pkseq.txt</pre>

	which generates <tt>generated.dat</tt> and <tt>generated.top</tt>.		which generates <tt>generated.dat</tt> and <tt>generated.top</tt>.
Line 57:		Line 57:
	We can thus run		We can thus run

	<pre>../../Release/oxDNA inputMD1</pre>		<pre>../../../Release/oxDNA inputMD1</pre>

	and wait (possibly a long time) until the pseudoknot forms. It is not		and wait (possibly a long time) until the pseudoknot forms. It is not

Snodinb: /* Introduction */

2013-10-10T10:55:29Z

Introduction

← Older revision		Revision as of 10:55, 10 October 2013
Line 18:		Line 18:

	A second option is to design a specific sequence, where we use "arbitrary"		A second option is to design a specific sequence, where we use "arbitrary"
	bases that only bind to one specific other base. This allows to eliminate		bases that only bind to one specific other base. This allows one to eliminate
	metastable states in the pseudoknot formation, so that one can safely lower		metastable states in the pseudoknot formation, so that one can safely lower
	the temperature at will (keeping in mind that the model is physically		the temperature at will (keeping in mind that the model is physically
Line 32:		Line 32:
	<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt>		<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt>

	~~All the~~ files needed to run this example are in the		The files needed to run this example are in the
	<tt>${oxDNA}/EXAMPLES/PSEUDOKNOT</tt> directory~~. The following assumes you~~		<tt>${oxDNA}/EXAMPLES/PSEUDOKNOT</tt> directory and its subdirectories.
	~~work in that directory~~.

	==Option 1: spontaneous formation==		==Option 1: spontaneous formation==

Romano: /* Introduction */

2012-04-18T00:37:35Z

Introduction

← Older revision		Revision as of 00:37, 18 April 2012
Line 24:		Line 24:

	A third option is to drive the formation of the pseudoknot with artificial		A third option is to drive the formation of the pseudoknot with artificial
	forces, as ~~one~~ in the [[Hairpin_formation\|hairpin formation]] example. This is probably the		forces, as done in the [[Hairpin_formation\|hairpin formation]] example. This is probably the
	most time-effective solution but requires a bit more work.		most time-effective solution but requires a bit more work.

	We study the following sequence that ~~forms~~, at low enough temperature,		We study the following sequence that is expected to form, at low enough temperature,
	~~drives the formation of a~~ pesudoknot with two 6-base pair stems and two		pesudoknot with two 6-base pair stems and two 8-base loops:
	8-base loops:

	<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt>		<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt>

Romano at 00:36, 18 April 2012

2012-04-18T00:36:17Z

← Older revision		Revision as of 00:36, 18 April 2012
Line 1:		Line 1:
	[[Category:Examples]]		[[Category:Examples]]


	~~WORK IN PROGRESS~~

	==Introduction==		==Introduction==
Line 40:		Line 37:
	work in that directory.		work in that directory.

	==Option 1==		==Option 1: spontaneous formation==
	You can run this example directly in the <tt>OPT1/</tt> directory.		You can run this example directly in the <tt>OPT1/</tt> directory.

Line 72:		Line 69:
	single hairpin will have around half of that.		single hairpin will have around half of that.

	== Option 2 ==		==Option 2: specific sequence==
	You can run this example directly in the <tt>OPT2/</tt> directory.		You can run this example directly in the <tt>OPT2/</tt> directory.

Line 111:		Line 108:
	<pre>../../Release/oxDNA inputMD2</pre>		<pre>../../Release/oxDNA inputMD2</pre>

	==Option 3==		==Option 3: forced formation==
	Why wait if we just want to form a structure and are not interested in how		Why wait if we just want to form a structure and are not interested in how
	it forms? The mutual_trap force is implemented exactly to form initial		it forms? The mutual_trap force is implemented exactly to form initial

Romano: /* Option 3 */

2012-04-17T22:49:11Z

Option 3

← Older revision		Revision as of 22:49, 17 April 2012
Line 127:		Line 127:
	the formation of the two stems in a relatively short time.		the formation of the two stems in a relatively short time.

	So, for each of the pairs, we set up a trap like this in		So, for each of the pairs, we set up a trap like this in <tt>external.conf</tt>:
	<tt>external.conf</tt>:

	<pre>		<pre>
Line 141:		Line 140:
	{		{
	type = mutual_trap		type = mutual_trap
	particle = 0		particle = 26
	ref_particle = 26		ref_particle = 0
	stiff = 1.		stiff = 1.
	r0 = 1.5		r0 = 1.5
Line 157:		Line 156:
	<pre>../../Release/oxDNA inputMC</pre>		<pre>../../Release/oxDNA inputMC</pre>

	should produce a pseudoknot within ~~half~~ an hour, maybe faster. In this case		should produce a pseudoknot within an hour, maybe faster. In this case
	we don't need the temperature to drive the formation of the motif, so we		we don't need the temperature to drive the formation of the motif, so we
	can use room temperature.		can use room temperature.

	~~If you have any questions about this example, you can e-mail Flavio Romano.~~