Pseudoknot formation: Difference between revisions
No edit summary |
m (Randisi moved page Pseudoknot to Pseudoknot formation: Title was too uninformative: now it's clear that the important bit is how to FORM a pseudoknot.) |
||
(16 intermediate revisions by 3 users not shown) | |||
Line 1: | Line 1: | ||
[[Category:Examples]] | [[Category:Examples]] | ||
==Introduction== | |||
One of the features of the model implemented in oxDNA is that it has a | One of the features of the model implemented in oxDNA is that it has a | ||
three-dimensional structure, so that it automatically incorporates | three-dimensional structure, so that it automatically incorporates | ||
Line 15: | Line 18: | ||
A second option is to design a specific sequence, where we use "arbitrary" | A second option is to design a specific sequence, where we use "arbitrary" | ||
bases that only bind to one specific other base. This allows to eliminate | bases that only bind to one specific other base. This allows one to eliminate | ||
metastable states in the pseudoknot formation, so that one can safely lower | metastable states in the pseudoknot formation, so that one can safely lower | ||
the temperature at will (keeping in mind that the model is physically | the temperature at will (keeping in mind that the model is physically | ||
Line 21: | Line 24: | ||
A third option is to drive the formation of the pseudoknot with artificial | A third option is to drive the formation of the pseudoknot with artificial | ||
forces, as | forces, as done in the [[Hairpin_formation|hairpin formation]] example. This is probably the | ||
most time-effective solution but requires a bit more work. | most time-effective solution but requires a bit more work. | ||
We study the following sequence that | We study the following sequence that is expected to form, at low enough temperature, | ||
pesudoknot with two 6-base pair stems and two 8-base loops: | |||
8-base loops: | |||
<tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt> | <tt>GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG</tt> | ||
The files needed to run this example are in the | |||
<tt>${oxDNA}/EXAMPLES/PSEUDOKNOT</tt> directory | <tt>${oxDNA}/EXAMPLES/PSEUDOKNOT</tt> directory and its subdirectories. | ||
==Option 1== | ==Option 1: spontaneous formation== | ||
You can run this example directly in the <tt>OPT1/</tt> directory. | You can run this example directly in the <tt>OPT1/</tt> directory. | ||
Line 42: | Line 43: | ||
<tt>pkseq.txt</tt> contains the above sequence. So, run | <tt>pkseq.txt</tt> contains the above sequence. So, run | ||
< | <pre>../../../UTILS/generate-sa.py 30. pkseq.txt</pre> | ||
which generates <tt>generated.dat</tt> and <tt>generated.top</tt>. | which generates <tt>generated.dat</tt> and <tt>generated.top</tt>. | ||
Line 56: | Line 57: | ||
We can thus run | We can thus run | ||
< | <pre>../../../Release/oxDNA inputMD1</pre> | ||
and wait (possibly a long time) until the pseudoknot forms. It is not | and wait (possibly a long time) until the pseudoknot forms. It is not | ||
Line 66: | Line 67: | ||
single hairpin will have around half of that. | single hairpin will have around half of that. | ||
==Option 2: specific sequence== | |||
== Option 2 == | |||
You can run this example directly in the <tt>OPT2/</tt> directory. | You can run this example directly in the <tt>OPT2/</tt> directory. | ||
Line 77: | Line 77: | ||
contains a working specific topology file for the impatient. | contains a working specific topology file for the impatient. | ||
< | <pre>cp generated.dat specific.dat</pre> | ||
As discussed in the description of the topology file, specific bases can be set up with | As discussed in the description of the topology file, specific bases can be set up with | ||
Line 104: | Line 104: | ||
more rarely, but it should make only correct ones. | more rarely, but it should make only correct ones. | ||
< | <pre>../../../Release/oxDNA inputMD2</pre> | ||
==Option 3: forced formation== | |||
==Option 3== | |||
Why wait if we just want to form a structure and are not interested in how | Why wait if we just want to form a structure and are not interested in how | ||
it forms? The mutual_trap force is implemented exactly to form initial | it forms? The mutual_trap force is implemented exactly to form initial | ||
configurations, | configurations, although one should bear in mind that while using external forces such as the mutual_trap force, the simulation path itself will be unphysical. But getting an initial | ||
configuration is sometimes half of the job. | configuration is sometimes half of the job. | ||
In this case we can use either of the topology | In this case we can use either of the topology files described above. We | ||
choose to use Monte Carlo, though, so that we don't have to worry about | choose to use Monte Carlo, though, so that we don't have to worry about | ||
tweaking the magnitude of the traps and the thermostat parameters not to | tweaking the magnitude of the traps and the thermostat parameters not to | ||
Line 123: | Line 122: | ||
the formation of the two stems in a relatively short time. | the formation of the two stems in a relatively short time. | ||
So, for each of the pairs, we set up a trap like this in | So, for each of the pairs, we set up a trap like this in <tt>external.conf</tt>: | ||
<tt>external.conf</tt>: | |||
< | <pre> | ||
{ | { | ||
type = mutual_trap | |||
type = mutual_trap | particle = 0 | ||
ref_particle = 26 | |||
particle = 0 | stiff = 1. | ||
r0 = 1.5 | |||
ref_particle = 26 | |||
stiff = 1. | |||
r0 = 1.5 | |||
} | } | ||
{ | { | ||
type = mutual_trap | |||
type = mutual_trap | particle = 26 | ||
ref_particle = 0 | |||
particle = | stiff = 1. | ||
r0 = 1.5 | |||
ref_particle = | |||
stiff = 1. | |||
r0 = 1.5 | |||
} | } | ||
</pre> | |||
</ | |||
Repeat the same block with the indexes 0 and 26 changed to 14 and 39. | Repeat the same block with the indexes 0 and 26 changed to 14 and 39. | ||
Line 165: | Line 149: | ||
Running the program | Running the program | ||
< | <pre>../../../Release/oxDNA inputMC</pre> | ||
should produce a pseudoknot within | should produce a pseudoknot within an hour, maybe faster. In this case | ||
we don't need the temperature to drive the formation of the motif, so we | we don't need the temperature to drive the formation of the motif, so we | ||
can use room temperature. | can use room temperature. | ||
Latest revision as of 21:34, 14 September 2016
Introduction
One of the features of the model implemented in oxDNA is that it has a three-dimensional structure, so that it automatically incorporates topological effects (see Ref 3). In this example we will see how to initialise a single strand in with a sequence designed to form a pseudoknot in its final configuration.
The simplest option is to just generate a single strand with the right sequence, let it run at low temperature and wait for it to form the pseudoknot. Unfortunately, this can be very slow, as the formation of the pseudoknot requires two rare events (the closure of two hairpins). One should keep in mind that lowering the temperature to drive the formation of the pseuoknot can backfire, since the life of metastable states becomes longer and longer. Nevertheless, this is a perfectly acceptable solution.
A second option is to design a specific sequence, where we use "arbitrary" bases that only bind to one specific other base. This allows one to eliminate metastable states in the pseudoknot formation, so that one can safely lower the temperature at will (keeping in mind that the model is physically meaningful only at temperatures where water is liquid).
A third option is to drive the formation of the pseudoknot with artificial forces, as done in the hairpin formation example. This is probably the most time-effective solution but requires a bit more work.
We study the following sequence that is expected to form, at low enough temperature, pesudoknot with two 6-base pair stems and two 8-base loops:
GTGCCGAAAAAAAACGCGAGACGGCACAAAAAAAACTCGCG
The files needed to run this example are in the ${oxDNA}/EXAMPLES/PSEUDOKNOT directory and its subdirectories.
Option 1: spontaneous formation
You can run this example directly in the OPT1/ directory.
First, we use the configuration generator to generate an input configuration for a single strand. The box size does not matter as long as it is big enough to contain the structure, so 30 s.u. will do. The file pkseq.txt contains the above sequence. So, run
../../../UTILS/generate-sa.py 30. pkseq.txt
which generates generated.dat and generated.top.
Now, we choose to run a Brownian dynamics simulation since it is much more efficient than Monte Carlo (in our implementation) in exploring phase space. We use the standard "aggressive" values for the thermostat (see [Thermostat]). We use the average model in this example. We set a fairly low temperature, let's say 20 Celsius, significantly below the melting temperature of the two hairpins in the average-base representation. A long simulation might be needed, so we start with 10^9 total steps.
We can thus run
../../../Release/oxDNA inputMD1
and wait (possibly a long time) until the pseudoknot forms. It is not guaranteed that the structure will for within the quite long simulation. To detect its formation, we can run the structure analyser to detect the formation of the correct bonds. Also, in the 5th column in the energy file (extensive base-pairing contribution to the total energy) you expect a number close to -8 for the formed structure (-0.7 times 12 base pairs). A single hairpin will have around half of that.
Option 2: specific sequence
You can run this example directly in the OPT2/ directory.
In this case, we have to repeat the all the steps above except that we need to manually tweak the topology file to have specific binding of the bases.
So, again generate the initial configuration with generate-sa.py and copy the topology file to a new one. The example directory already contains a working specific topology file for the impatient.
cp generated.dat specific.dat
As discussed in the description of the topology file, specific bases can be set up with two-digit numbers in the second column of the topology file, and complementarity is implemented if the sum is equal to 3 (negative numbers can be used). So if we want base number 0 and 26 to be bound, we can set their "type" (second column) to be 100 and -97, respectively. Pay close attention when modifying by hand the topology file, since it is very easy to make mistakes (base types don't add up to 3, using the wrong number, etc.). It makes sense to automatise this task.
In this case, we want bases 0-5 to be bound to bases 26-21 and bases 14-19 to be bound to bases 41-36. Modify the topology file so that complementary pairs have types corresponding to numbers with magnitude grater than 10 and that add up to 3. The poly-A sections in the loop can be left as A's in the topology file.
If you look into the file inputMD2, you will see that it is the same as inputMD1 except that it uses specific.top as the topology file. If you decide to use the ready specific topology file, just copy it to specific.top. The temperature has also been lowered to 0C, since we expect no unwanted metastable states.
You can now run the code and see what happens. It should make base-pairs more rarely, but it should make only correct ones.
../../../Release/oxDNA inputMD2
Option 3: forced formation
Why wait if we just want to form a structure and are not interested in how it forms? The mutual_trap force is implemented exactly to form initial configurations, although one should bear in mind that while using external forces such as the mutual_trap force, the simulation path itself will be unphysical. But getting an initial configuration is sometimes half of the job.
In this case we can use either of the topology files described above. We choose to use Monte Carlo, though, so that we don't have to worry about tweaking the magnitude of the traps and the thermostat parameters not to make the system explode.
First of all, we have to generate a file where we specify the external forces. We set up 4 traps, a mutual trap between particles 0 and 26 and a mutual trap between particles 14 and 39. These should be enough to drive the formation of the two stems in a relatively short time.
So, for each of the pairs, we set up a trap like this in external.conf:
{ type = mutual_trap particle = 0 ref_particle = 26 stiff = 1. r0 = 1.5 } { type = mutual_trap particle = 26 ref_particle = 0 stiff = 1. r0 = 1.5 }
Repeat the same block with the indexes 0 and 26 changed to 14 and 39.
The file inputMC is a Monte Carlo input file with everything set up to use the external.conf file you just created.
Running the program
../../../Release/oxDNA inputMC
should produce a pseudoknot within an hour, maybe faster. In this case we don't need the temperature to drive the formation of the motif, so we can use room temperature.